Product Details

SNP ID: rs1059297
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:33299751 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACGATTAGACCCGTTACCCCGTGG[C/G]TCTGGCCGACCGTCCTGACTCGGAG
Phenotype: MIM: 605660 MIM: 602306 MIM: 601962
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MIR6834 PubMed Links

Gene Details

Gene: MIR6834
Gene Name: microRNA 6834

There are no transcripts associated with this gene.

Gene: PFDN6
Gene Name: prefoldin subunit 6

There are no transcripts associated with this gene.

Gene: RGL2
Gene Name: ral guanine nucleotide dissociation stimulator like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243738.1	3534	Intron			NP_001230667.1
NM_004761.4	3534	Intron			NP_004752.1
XM_011514781.1	3534	Intron			XP_011513083.1
XM_011514785.2	3534	Intron			XP_011513087.1

Gene: TAPBP
Gene Name: TAP binding protein (tapasin)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003190.4	3534	UTR 3			NP_003181.3
NM_172208.2	3534	Intron			NP_757345.2
NM_172209.2	3534	UTR 3			NP_757346.2
XM_011514828.2	3534	UTR 3			XP_011513130.1
XM_017011227.1	3534	UTR 3			XP_016866716.1

View Full Product Details