Product Details

SNP ID
rs1048364
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:100749656 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
CCTATAAAATGGTAGGCAATCTCAT[C/T]GTGCATTATCTTTTTGTGCTCAGAC
Phenotype
MIM: 606279 MIM: 602498
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
ABI3BP PubMed Links
Additional Information
For this assay, SNP(s) [rs573536899] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ABI3BP
Gene Name
ABI family member 3 binding protein
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_015429.3 6174 UTR 3 NP_056244.2
XM_005247281.2 6174 UTR 3 XP_005247338.1
XM_005247282.2 6174 UTR 3 XP_005247339.1
XM_005247283.2 6174 UTR 3 XP_005247340.1
XM_005247284.2 6174 UTR 3 XP_005247341.1
XM_005247285.2 6174 UTR 3 XP_005247342.1
XM_005247287.2 6174 UTR 3 XP_005247344.1
XM_005247288.2 6174 UTR 3 XP_005247345.1
XM_005247289.2 6174 UTR 3 XP_005247346.1
XM_005247290.2 6174 UTR 3 XP_005247347.1
XM_005247291.2 6174 UTR 3 XP_005247348.1
XM_005247293.2 6174 UTR 3 XP_005247350.1
XM_005247294.2 6174 UTR 3 XP_005247351.1
XM_005247295.2 6174 UTR 3 XP_005247352.1
XM_005247296.2 6174 UTR 3 XP_005247353.1
XM_005247298.2 6174 UTR 3 XP_005247355.1
XM_005247299.3 6174 UTR 3 XP_005247356.1
XM_005247300.2 6174 UTR 3 XP_005247357.1
XM_005247301.2 6174 UTR 3 XP_005247358.1
XM_005247302.2 6174 UTR 3 XP_005247359.1
XM_005247303.2 6174 UTR 3 XP_005247360.1
XM_005247305.2 6174 UTR 3 XP_005247362.1
XM_005247306.2 6174 UTR 3 XP_005247363.1
XM_005247309.1 6174 UTR 3 XP_005247366.1
XM_006713569.2 6174 UTR 3 XP_006713632.1
XM_006713570.2 6174 UTR 3 XP_006713633.1
XM_006713571.2 6174 UTR 3 XP_006713634.1
XM_006713572.2 6174 UTR 3 XP_006713635.1
XM_011512639.1 6174 UTR 3 XP_011510941.1
XM_011512640.1 6174 UTR 3 XP_011510942.1
XM_011512641.1 6174 UTR 3 XP_011510943.1
XM_011512643.1 6174 UTR 3 XP_011510945.1
XM_011512644.1 6174 UTR 3 XP_011510946.1
XM_011512645.1 6174 UTR 3 XP_011510947.1
XM_011512646.1 6174 UTR 3 XP_011510948.1
XM_011512647.1 6174 UTR 3 XP_011510949.1
XM_011512648.1 6174 UTR 3 XP_011510950.1
XM_011512649.1 6174 UTR 3 XP_011510951.1
XM_011512651.1 6174 UTR 3 XP_011510953.1
XM_011512652.1 6174 UTR 3 XP_011510954.1
XM_011512653.1 6174 UTR 3 XP_011510955.1
XM_011512654.1 6174 UTR 3 XP_011510956.1
XM_011512656.1 6174 UTR 3 XP_011510958.1
XM_011512657.1 6174 UTR 3 XP_011510959.1
XM_011512658.1 6174 UTR 3 XP_011510960.1
XM_011512659.1 6174 UTR 3 XP_011510961.1
XM_011512660.1 6174 UTR 3 XP_011510962.1
XM_017006105.1 6174 UTR 3 XP_016861594.1
XM_017006106.1 6174 UTR 3 XP_016861595.1
XM_017006107.1 6174 UTR 3 XP_016861596.1
XM_017006108.1 6174 UTR 3 XP_016861597.1
Gene
TFG
Gene Name
TRK-fused gene
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001007565.2 6174 Intron NP_001007566.1
NM_001195478.1 6174 Intron NP_001182407.1
NM_001195479.1 6174 Intron NP_001182408.1
NM_006070.5 6174 Intron NP_006061.2
XM_005247066.1 6174 Intron XP_005247123.1
XM_006713472.1 6174 Intron XP_006713535.1
XM_006713473.1 6174 Intron XP_006713536.1
XM_011512334.1 6174 Intron XP_011510636.1
XM_017005527.1 6174 Intron XP_016861016.1
XM_017005528.1 6174 Intron XP_016861017.1
XM_017005529.1 6174 Intron XP_016861018.1
XM_017005530.1 6174 Intron XP_016861019.1

View Full Product Details