Product Details

SNP ID: rs11606393
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:208235 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTTCCCGGCTCACTTCCCACCGTCC[A/G]GTGTCAGCAAAAACAGCACTTCCTC
Phenotype: MIM: 615417 MIM: 608356 MIM: 609146 MIM: 604481
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BET1L PubMed Links

Gene Details

Gene: BET1L
Gene Name: Bet1 golgi vesicular membrane trafficking protein like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098787.1	725	Intron			NP_001092257.1
NM_016526.4	725	Intron			NP_057610.2

Gene: MIR6743
Gene Name: microRNA 6743

There are no transcripts associated with this gene.

Gene: ODF3
Gene Name: outer dense fiber of sperm tails 3

There are no transcripts associated with this gene.

Gene: RIC8A
Gene Name: RIC8 guanine nucleotide exchange factor A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286134.1	725	UTR 5			NP_001273063.1
NM_021932.5	725	UTR 5			NP_068751.4
XM_005253052.3	725	Intron			XP_005253109.1
XM_017018107.1	725	Intron			XP_016873596.1

Gene: SIRT3
Gene Name: sirtuin 3

There are no transcripts associated with this gene.

View Full Product Details