Product Details

SNP ID: rs140565500
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6872286 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGCGGACCTGGCACTGGCCCCAGA[C/T]AGCGCTTACTGCCGGATAGAGGGTC
Phenotype: MIM: 611658 MIM: 190450 MIM: 601447
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC105369632 PubMed Links

Gene Details

Gene: LOC105369632
Gene Name: uncharacterized LOC105369632

There are no transcripts associated with this gene.

Gene: SPSB2
Gene Name: splA/ryanodine receptor domain and SOCS box containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001146316.1	1072	Missense Mutation	ATC,GTC	I206V	NP_001139788.1
NM_001319670.1	1072	Missense Mutation	ATC,GTC	I206V	NP_001306599.1
NM_032641.3	1072	Missense Mutation	ATC,GTC	I206V	NP_116030.1

Gene: TPI1
Gene Name: triosephosphate isomerase 1

There are no transcripts associated with this gene.

Gene: USP5
Gene Name: ubiquitin specific peptidase 5

There are no transcripts associated with this gene.

View Full Product Details