Product Details

SNP ID: rs74766284
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:5000265 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGAGCTATGGCTGGTGCCTCGGTG[A/G]AAGTGGCAGTGAGGGTTCGGCCCTT
Phenotype: MIM: 603060
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: INCA1 PubMed Links

Gene Details

Gene: INCA1
Gene Name: inhibitor of CDK, cyclin A1 interacting protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001167985.1	367	Intron			NP_001161457.1
NM_001167986.1	367	Intron			NP_001161458.1
NM_001167987.1	367	Intron			NP_001161459.1
NM_213726.2	367	Intron			NP_998891.2

Gene: KIF1C
Gene Name: kinesin family member 1C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006612.5	367	Missense Mutation	AAA,GAA	K7E	NP_006603.2
XM_005256424.2	367	Missense Mutation	AAA,GAA	K7E	XP_005256481.1

Gene: LOC101927979
Gene Name: translation initiation factor IF-2

There are no transcripts associated with this gene.

View Full Product Details