Product Details

SNP ID: rs116479225
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:53188231 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACAAAAGGAAAAACGGGGTGGAG[C/G]AGACAAGGGCTGGATCCAAAAAGTG
Phenotype: MIM: 616569 MIM: 147559
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CSAD PubMed Links

Gene Details

Gene: CSAD
Gene Name: cysteine sulfinic acid decarboxylase

There are no transcripts associated with this gene.

Gene: ITGB7
Gene Name: integrin subunit beta 7

There are no transcripts associated with this gene.

Gene: ZNF740
Gene Name: zinc finger protein 740

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004304.3	1851	UTR 3			NP_001004304.1
XM_006719344.2	1851	Intron			XP_006719407.1
XM_011538194.2	1851	Intron			XP_011536496.1
XM_017019181.1	1851	UTR 3			XP_016874670.1

View Full Product Details