Product Details

SNP ID: rs141187412
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:47579324 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGTGAGGCGGGAGAGCGCCGGGGC[C/T]GACACGCGCCGTGAGTATGTGCGGG
Phenotype: MIM: 603846 MIM: 609538
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM180B PubMed Links

Gene Details

Gene: FAM180B
Gene Name: family with sequence similarity 180 member B

There are no transcripts associated with this gene.

Gene: KBTBD4
Gene Name: kelch repeat and BTB domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318716.1	205	Intron			NP_001305645.1
NM_001318717.1	205	Intron			NP_001305646.1
NM_001318718.1	205	Intron			NP_001305647.1
NM_001318719.1	205	Intron			NP_001305648.1
NM_001318720.1	205	Intron			NP_001305649.1
NM_001318721.1	205	Intron			NP_001305650.1
NM_001318722.1	205	Intron			NP_001305651.1
NM_001318723.1	205	Intron			NP_001305652.1
NM_001318724.1	205	Intron			NP_001305653.1
NM_001318725.1	205	Intron			NP_001305654.1
NM_016506.6	205	Intron			NP_057590.3
NM_018095.5	205	Intron			NP_060565.4
XM_017018009.1	205	Intron			XP_016873498.1

Gene: NDUFS3
Gene Name: NADH:ubiquinone oxidoreductase core subunit S3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004551.2	205	Silent Mutation	GCC,GCT	A41A	NP_004542.1

Gene: PTPMT1
Gene Name: protein tyrosine phosphatase, mitochondrial 1

There are no transcripts associated with this gene.

View Full Product Details