Product Details

SNP ID: rs147786390
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65129904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAAAGCCCGCAGGGGGCACAGGCA[C/T]TGGGGGGAAGGCTGGAGAGAGAGAG
Phenotype: MIM: 134690 MIM: 606866 MIM: 608046
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAU PubMed Links

Gene Details

Gene: FAU
Gene Name: FAU, ubiquitin like and ribosomal protein S30 fusion

There are no transcripts associated with this gene.

Gene: MIR6751
Gene Name: microRNA 6751

There are no transcripts associated with this gene.

Gene: MRPL49
Gene Name: mitochondrial ribosomal protein L49

There are no transcripts associated with this gene.

Gene: SYVN1
Gene Name: synoviolin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032431.2	2362	Missense Mutation	ATG,GTG	M473V	NP_115807.1
NM_172230.2	2362	Missense Mutation	ATG,GTG	M474V	NP_757385.1
XM_011545303.2	2362	Missense Mutation	ATG,GTG	M474V	XP_011543605.1

View Full Product Details