Product Details

SNP ID: rs148690847
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64243490 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAAGCGCAAGCTGGTGATCCCATC[C/G]GAGCTAGGTAAGAGGCCCCTCCTGA
Phenotype: MIM: 604189 MIM: 186946 MIM: 600230 MIM: 601140 MIM: 601398
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DNAJC4 PubMed Links

Gene Details

Gene: DNAJC4
Gene Name: DnaJ heat shock protein family (Hsp40) member C4

There are no transcripts associated with this gene.

Gene: FKBP2
Gene Name: FK506 binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135208.1	520	Silent Mutation	TCC,TCG	S108S	NP_001128680.1
NM_004470.3	520	Silent Mutation	TCC,TCG	S108S	NP_004461.2
NM_057092.2	520	Silent Mutation	TCC,TCG	S108S	NP_476433.1
XM_005273848.3	520	Silent Mutation	TCC,TCG	S108S	XP_005273905.1

Gene: LOC105369340
Gene Name: uncharacterized LOC105369340

There are no transcripts associated with this gene.

Gene: PLCB3
Gene Name: phospholipase C beta 3

There are no transcripts associated with this gene.

Gene: PPP1R14B
Gene Name: protein phosphatase 1 regulatory inhibitor subunit 14B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138689.2	520	Intron			NP_619634.1

Gene: VEGFB
Gene Name: vascular endothelial growth factor B

There are no transcripts associated with this gene.

View Full Product Details