Product Details

SNP ID: rs147284580
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:122987336 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGGGTCGCTGCCCATGATGGACA[C/T]GCTAGCGGCAAAGGAACCGTCGATG
Phenotype: MIM: 607668 MIM: 608920
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARL6IP4 PubMed Links

Gene Details

Gene: ARL6IP4
Gene Name: ADP ribosylation factor like GTPase 6 interacting protein 4

There are no transcripts associated with this gene.

Gene: OGFOD2
Gene Name: 2-oxoglutarate and iron dependent oxygenase domain containing 2

There are no transcripts associated with this gene.

Gene: PITPNM2
Gene Name: phosphatidylinositol transfer protein membrane associated 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300801.1	3819	Missense Mutation	ATG,GTG	M1114V	NP_001287730.1
NM_020845.2	3819	Missense Mutation	ATG,GTG	M1120V	NP_065896.1
XM_011538590.2	3819	Missense Mutation	ATG,GTG	M1153V	XP_011536892.1

View Full Product Details