Product Details

SNP ID
rs137979740
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.16:57152978 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTGCTCTGCCTGCCGGCATCACAGT[C/G]TCAACACATTTTGTGTGTGTCTCAC
Phenotype
MIM: 604206
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
CPNE2 PubMed Links

Gene Details

Gene
CPNE2
Gene Name
copine 2
There are no transcripts associated with this gene.

Gene
FAM192A
Gene Name
family with sequence similarity 192 member A
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_024946.2 2336 UTR 3 NP_079222.1
XM_005256156.4 2336 UTR 3 XP_005256213.1
XM_005256158.3 2336 UTR 3 XP_005256215.1
XM_005256160.2 2336 UTR 3 XP_005256217.1
XM_005256163.2 2336 UTR 3 XP_005256220.1
XM_005256164.3 2336 UTR 3 XP_005256221.1
XM_005256165.2 2336 UTR 3 XP_005256222.1
XM_006721275.3 2336 UTR 3 XP_006721338.2
XM_011523343.2 2336 UTR 3 XP_011521645.1
XM_017023681.1 2336 UTR 3 XP_016879170.1
XM_017023682.1 2336 UTR 3 XP_016879171.1
XM_017023683.1 2336 UTR 3 XP_016879172.1
XM_017023684.1 2336 UTR 3 XP_016879173.1
XM_017023685.1 2336 UTR 3 XP_016879174.1
XM_017023686.1 2336 UTR 3 XP_016879175.1
XM_017023687.1 2336 UTR 3 XP_016879176.1
XM_017023688.1 2336 UTR 3 XP_016879177.1
XM_017023689.1 2336 UTR 3 XP_016879178.1
XM_017023690.1 2336 UTR 3 XP_016879179.1
XM_017023691.1 2336 UTR 3 XP_016879180.1
XM_017023692.1 2336 UTR 3 XP_016879181.1
XM_017023693.1 2336 UTR 3 XP_016879182.1
XM_017023694.1 2336 UTR 3 XP_016879183.1
XM_017023695.1 2336 UTR 3 XP_016879184.1
XM_017023696.1 2336 UTR 3 XP_016879185.1
XM_017023697.1 2336 UTR 3 XP_016879186.1
XM_017023698.1 2336 UTR 3 XP_016879187.1
XM_017023699.1 2336 UTR 3 XP_016879188.1
XM_017023700.1 2336 UTR 3 XP_016879189.1
XM_017023701.1 2336 UTR 3 XP_016879190.1
XM_017023702.1 2336 UTR 3 XP_016879191.1
XM_017023703.1 2336 UTR 3 XP_016879192.1
XM_017023704.1 2336 UTR 3 XP_016879193.1

View Full Product Details