Product Details

SNP ID

rs141859760

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.16:57153517 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTGGCTATTAGTAAACAAGGCCTAC[A/G]TTTGTTTCTCTAAAATTTAGAATCT

Phenotype

MIM: 604206

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CPNE2 PubMed Links

Gene Details

Gene

CPNE2

Gene Name

copine 2

There are no transcripts associated with this gene.

Gene

FAM192A

Gene Name

family with sequence similarity 192 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024946.2	1797	UTR 3			NP_079222.1
XM_005256156.4	1797	UTR 3			XP_005256213.1
XM_005256158.3	1797	UTR 3			XP_005256215.1
XM_005256160.2	1797	UTR 3			XP_005256217.1
XM_005256163.2	1797	UTR 3			XP_005256220.1
XM_005256164.3	1797	UTR 3			XP_005256221.1
XM_005256165.2	1797	UTR 3			XP_005256222.1
XM_006721275.3	1797	UTR 3			XP_006721338.2
XM_011523343.2	1797	UTR 3			XP_011521645.1
XM_017023681.1	1797	UTR 3			XP_016879170.1
XM_017023682.1	1797	UTR 3			XP_016879171.1
XM_017023683.1	1797	UTR 3			XP_016879172.1
XM_017023684.1	1797	UTR 3			XP_016879173.1
XM_017023685.1	1797	UTR 3			XP_016879174.1
XM_017023686.1	1797	UTR 3			XP_016879175.1
XM_017023687.1	1797	UTR 3			XP_016879176.1
XM_017023688.1	1797	UTR 3			XP_016879177.1
XM_017023689.1	1797	UTR 3			XP_016879178.1
XM_017023690.1	1797	UTR 3			XP_016879179.1
XM_017023691.1	1797	UTR 3			XP_016879180.1
XM_017023692.1	1797	UTR 3			XP_016879181.1
XM_017023693.1	1797	UTR 3			XP_016879182.1
XM_017023694.1	1797	UTR 3			XP_016879183.1
XM_017023695.1	1797	UTR 3			XP_016879184.1
XM_017023696.1	1797	UTR 3			XP_016879185.1
XM_017023697.1	1797	UTR 3			XP_016879186.1
XM_017023698.1	1797	UTR 3			XP_016879187.1
XM_017023699.1	1797	UTR 3			XP_016879188.1
XM_017023700.1	1797	UTR 3			XP_016879189.1
XM_017023701.1	1797	UTR 3			XP_016879190.1
XM_017023702.1	1797	UTR 3			XP_016879191.1
XM_017023703.1	1797	UTR 3			XP_016879192.1
XM_017023704.1	1797	UTR 3			XP_016879193.1

View Full Product Details