Product Details

SNP ID: rs139073171
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2098092 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGACCATCTCCTGCAACAACTGCAC[A/G]GACTCGCACGTCGCCTGCTTTGGCT
Phenotype: MIM: 607246
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AP3D1 PubMed Links

Gene Details

Gene: AP3D1
Gene Name: adaptor related protein complex 3 delta 1 subunit

There are no transcripts associated with this gene.

Gene: IZUMO4
Gene Name: IZUMO family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031735.2	536	Silent Mutation	ACA,ACG	T146T	NP_001026905.2
NM_001039846.1	536	Silent Mutation	ACA,ACG	T146T	NP_001034935.1
XM_005259480.3	536	Silent Mutation	ACA,ACG	T146T	XP_005259537.2

Gene: MOB3A
Gene Name: MOB kinase activator 3A

There are no transcripts associated with this gene.

View Full Product Details