Product Details

SNP ID: rs141542300
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54839534 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCATCTATCCAGGGAAGGGGAGGCC[C/T]ATGAACGTAGGCTCCCTGCAGTGCG
Phenotype: MIM: 604955 MIM: 604946
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: KIR2DS4 PubMed Links
Additional Information: For this assay, SNP(s) [rs4806591] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: KIR2DS4
Gene Name: killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281971.1	566	Silent Mutation	CCC,CCT	P159P	NP_001268900.1
NM_001281972.1	566	Silent Mutation	CCC,CCT	P159P	NP_001268901.1
NM_012314.5	566	Intron			NP_036446.3

Gene: KIR3DL1
Gene Name: killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1

There are no transcripts associated with this gene.