Product Details
- SNP ID
-
rs142466418
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
14
- Location
-
Chr.1:23559002 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTTGTCGTTGGAGATGACAAGTTC[C/T]GGAGTGAGCTCGGCTGTCTGATTAG
- Phenotype
-
MIM: 600277
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ID3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11574] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ID3
- Gene Name
- inhibitor of DNA binding 3, HLH protein
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_002167.4 |
686 |
Silent Mutation |
|
|
NP_002158.3 |
View Full Product Details