Product Details

SNP ID: rs141950713
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:40860721 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCTGGAGTGCAGTGGCGTGATCC[C/G]ATTACACTGCAACCTATGTCTTCCA
Phenotype: MIM: 611336 MIM: 606796 MIM: 613553
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DNAJB7 PubMed Links

Gene Details

Gene: DNAJB7
Gene Name: DnaJ heat shock protein family (Hsp40) member B7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145174.1	209	UTR 3			NP_660157.1

Gene: ST13
Gene Name: suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

There are no transcripts associated with this gene.

Gene: XPNPEP3
Gene Name: X-prolyl aminopeptidase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204827.1	209	Silent Mutation	CCC,CCG	P36P	NP_001191756.1
NM_022098.3	209	Intron			NP_071381.1

View Full Product Details