Product Details

SNP ID: rs144316335
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49098373 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCACAGTCGCTCATAGAGGCGAAC[C/T]TCACACATCAAAGGCTGTGACACCC
Phenotype: MIM: 603727 MIM: 614471
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6890 PubMed Links

Gene Details

Gene: MIR6890
Gene Name: microRNA 6890

There are no transcripts associated with this gene.

Gene: QARS
Gene Name: glutaminyl-tRNA synthetase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272073.1	2140	Silent Mutation	GAA,GAG	E677E	NP_001259002.1
NM_005051.2	2140	Silent Mutation	GAA,GAG	E688E	NP_005042.1
XM_017006965.1	2140	Silent Mutation	GAA,GAG	E706E	XP_016862454.1

Gene: QRICH1
Gene Name: glutamine rich 1

There are no transcripts associated with this gene.

Gene: USP19
Gene Name: ubiquitin specific peptidase 19

There are no transcripts associated with this gene.

View Full Product Details