Product Details

SNP ID: rs145216913
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:73704209 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCGCGGTAGTCGGACTGCGTGGC[A/G]TTGTACTCCGACATGACCTCCACAA
Phenotype: MIM: 186590 MIM: 615733
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR4284 PubMed Links

Gene Details

Gene: MIR4284
Gene Name: microRNA 4284

There are no transcripts associated with this gene.

Gene: STX1A
Gene Name: syntaxin 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001165903.1	476	Silent Mutation	AAC,AAT	N135N	NP_001159375.1
NM_004603.3	476	Silent Mutation	AAC,AAT	N135N	NP_004594.1
XM_017012567.1	476	Silent Mutation	AAC,AAT	N135N	XP_016868056.1

Gene: WBSCR22
Gene Name: Williams-Beuren syndrome chromosome region 22

There are no transcripts associated with this gene.

View Full Product Details