Product Details

SNP ID: rs143539459
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:124855903 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGACGGTCAGCTTCAGCCCTGACT[C/T]GAGACAGCTGGCATCAGGTGGCTGG
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARPC5L PubMed Links

Gene Details

Gene: ARPC5L
Gene Name: actin related protein 2/3 complex subunit 5 like

There are no transcripts associated with this gene.

Gene: RPL35
Gene Name: ribosomal protein L35

There are no transcripts associated with this gene.

Gene: WDR38
Gene Name: WD repeat domain 38

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001045476.2	432	Missense Mutation	TCG,TTG	S117L	NP_001038941.1
NM_001276374.1	432	Missense Mutation	TCG,TTG	S117L	NP_001263303.1
NM_001276375.1	432	Missense Mutation	TCG,TTG	S106L	NP_001263304.1
NM_001276376.1	432	Missense Mutation	TCG,TTG	S68L	NP_001263305.1
XM_005251987.3	432	Missense Mutation	TCG,TTG	S117L	XP_005252044.1

View Full Product Details