Product Details

SNP ID: rs202147105
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:100973222 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAGCAAGGCTGCTGGTGGGAGCCC[A/G]AGGTGCCCTGTTCTCTCTCAGTGCC
Phenotype: MIM: 611848 MIM: 610348
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR608 PubMed Links

Gene Details

Gene: MIR608
Gene Name: microRNA 608

There are no transcripts associated with this gene.

Gene: MRPL43
Gene Name: mitochondrial ribosomal protein L43

There are no transcripts associated with this gene.

Gene: SEMA4G
Gene Name: semaphorin 4G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001203244.1	602	Missense Mutation	CAA,CGA	Q73R	NP_001190173.1
NM_017893.3	602	Missense Mutation	CAA,CGA	Q73R	NP_060363.2
XM_005270008.2	602	Missense Mutation	CAA,CGA	Q73R	XP_005270065.1

Gene: SLF2
Gene Name: SMC5-SMC6 complex localization factor 2

There are no transcripts associated with this gene.

View Full Product Details