Product Details

SNP ID: rs201501335
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:43361348 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTTTCCACACTCTTCACATTGAT[A/G]GGGCTTTTCTCCTGTGTGGGTTCTC
Phenotype: MIM: 609610
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADAL PubMed Links

Gene Details

Gene: ADAL
Gene Name: adenosine deaminase like

There are no transcripts associated with this gene.

Gene: TUBGCP4
Gene Name: tubulin gamma complex associated protein 4

There are no transcripts associated with this gene.

Gene: ZSCAN29
Gene Name: zinc finger and SCAN domain containing 29

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152455.3	2871	Missense Mutation	CAT,TAT	H762Y	NP_689668.3
XM_006720401.3	2871	Missense Mutation	CAT,TAT	H762Y	XP_006720464.1
XM_011521266.2	2871	Missense Mutation	CAT,TAT	H762Y	XP_011519568.1
XM_017021949.1	2871	Intron			XP_016877438.1

View Full Product Details