Product Details

SNP ID: rs201102355
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67184488 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCGGGCACTAGGCTGAAGAGGACG[C/T]GGCGGCTCGCGCGGGGCGACGGCGG
Phenotype: MIM: 600659 MIM: 614117 MIM: 605235
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: E2F4 PubMed Links

Gene Details

Gene: E2F4
Gene Name: E2F transcription factor 4

There are no transcripts associated with this gene.

Gene: EXOC3L1
Gene Name: exocyst complex component 3 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178516.3	2388	Missense Mutation	CAC,CGC	H716R	NP_848611.2

Gene: KIAA0895L
Gene Name: KIAA0895 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040715.1	2388	Intron			NP_001035805.1

Gene: NOL3
Gene Name: nucleolar protein 3

There are no transcripts associated with this gene.

View Full Product Details