Product Details
- SNP ID
-
rs202017139
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.16:66935709 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTCTGCTGCTTCTTGTCCGGGGCC[A/C]GGGTGAGGCTCCCTCGGAGGGGCGA
- Phenotype
-
MIM: 605278
MIM: 614778
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CES2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11863141] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CES2
- Gene Name
- carboxylesterase 2
- Gene
- FAM96B
- Gene Name
- family with sequence similarity 96 member B
There are no transcripts associated with this gene.
View Full Product Details