Product Details

SNP ID: rs202164467
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:66934248 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAAGATCTCGCGTGCGTCGATGCT[G/T]TCGGGAACCTGCTCGTCCTCCTCGC
Phenotype: MIM: 605278 MIM: 614778 MIM: 179503
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CES2 PubMed Links

Gene Details

Gene: CES2
Gene Name: carboxylesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003869.5	176	Intron			NP_003860.2
NM_198061.2	176	Intron			NP_932327.1
XM_011523421.2	176	Intron			XP_011521723.1
XM_017023818.1	176	Intron			XP_016879307.1

Gene: FAM96B
Gene Name: family with sequence similarity 96 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016062.3	176	Missense Mutation	GAA,GAC	E39D	NP_057146.1

Gene: RRAD
Gene Name: RRAD, Ras related glycolysis inhibitor and calcium channel regulator

There are no transcripts associated with this gene.

View Full Product Details