Product Details

SNP ID: rs200997964
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1387826 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTCTGCAGCTCCTGGCCTGCGCG[A/G]CTTCCGGATCCTTGGTCTGCGGTGA
Phenotype: MIM: 601240 MIM: 601825
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GAMT PubMed Links

Gene Details

Gene: GAMT
Gene Name: guanidinoacetate N-methyltransferase

There are no transcripts associated with this gene.

Gene: MUM1
Gene Name: melanoma associated antigen (mutated) 1

There are no transcripts associated with this gene.

Gene: NDUFS7
Gene Name: NADH:ubiquinone oxidoreductase core subunit S7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024407.4	75	Missense Mutation	GAC,GGC	D11G	NP_077718.3
XM_005259556.4	75	Missense Mutation	GAC,GGC	D11G	XP_005259613.2
XM_017026768.1	75	Missense Mutation	GAC,GGC	D96G	XP_016882257.1

View Full Product Details