Product Details

SNP ID
rs200149481
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.21:36036232 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TAGTTGGTTTATCAGGGCCTCTTTT[G/T]CATCCTTCATATGAGACACCTGAAA
Phenotype
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
SETD4 PubMed Links
Additional Information
For this assay, SNP(s) [rs68024241] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
SETD4
Gene Name
SET domain containing 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001007259.2 1415 Intron NP_001007260.1
NM_001007261.2 1415 Intron NP_001007262.1
NM_001286752.1 1415 Missense Mutation GAA,GCA E379A NP_001273681.1
NM_017438.4 1415 Missense Mutation GAA,GCA E403A NP_059134.1
XM_011529636.1 1415 Missense Mutation GAA,GCA E403A XP_011527938.1
XM_011529637.1 1415 Missense Mutation GAA,GCA E403A XP_011527939.1
XM_011529638.2 1415 Missense Mutation GAA,GCA E403A XP_011527940.1
XM_011529639.1 1415 Missense Mutation GAA,GCA E403A XP_011527941.1
XM_011529640.2 1415 Missense Mutation GAA,GCA E403A XP_011527942.1
XM_011529642.1 1415 Missense Mutation GAA,GCA E379A XP_011527944.1
XM_011529643.1 1415 Missense Mutation GAA,GCA E379A XP_011527945.1
XM_011529644.1 1415 Missense Mutation GAA,GCA E379A XP_011527946.1
XM_017028403.1 1415 Missense Mutation GAA,GCA E403A XP_016883892.1
XM_017028404.1 1415 Missense Mutation GAA,GCA E379A XP_016883893.1
XM_017028405.1 1415 Intron XP_016883894.1

View Full Product Details