Product Details

SNP ID: rs200620999
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.5:23509991 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCAAACTCCAGGTGGATGACACA[A/G]AAGATTCTGATGAAGAATGGACCCC
Phenotype: MIM: 609760
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: PRDM9 PubMed Links
Additional Information: For this assay, SNP(s) [rs2973615] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001310214.1	453	Intron			NP_001297143.1
NM_020227.3	453	Missense Mutation	AAA,GAA	K89E	NP_064612.2