Product Details

SNP ID: rs202096147
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144510368 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCCCACCACCCAAGGTGAGCAG[A/G]GTGCCAGCAGCCTGTTTCCTCTTCT
Phenotype: MIM: 138200 MIM: 609172 MIM: 603780
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GPT PubMed Links

Gene Details

Gene: GPT
Gene Name: glutamic--pyruvic transaminase

There are no transcripts associated with this gene.

Gene: LOC101928953
Gene Name: uncharacterized LOC101928953

There are no transcripts associated with this gene.

Gene: LRRC14
Gene Name: leucine rich repeat containing 14

There are no transcripts associated with this gene.

Gene: MFSD3
Gene Name: major facilitator superfamily domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_138431.2	1936	Missense Mutation	AGT,GGT	S231G	NP_612440.1
XM_011516806.2	1936	Missense Mutation	GAG,GGG	E228G	XP_011515108.1
XM_017013005.1	1936	Missense Mutation	AGT,GGT	S231G	XP_016868494.1

Gene: PPP1R16A
Gene Name: protein phosphatase 1 regulatory subunit 16A

There are no transcripts associated with this gene.

Gene: RECQL4
Gene Name: RecQ like helicase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004260.3	1936	Intron			NP_004251.3
XM_011517384.2	1936	Intron			XP_011515686.1
XM_017013991.1	1936	Intron			XP_016869480.1
XM_017013992.1	1936	Intron			XP_016869481.1
XM_017013993.1	1936	Intron			XP_016869482.1
XM_017013994.1	1936	Intron			XP_016869483.1
XM_017013995.1	1936	Intron			XP_016869484.1
XM_017013996.1	1936	Intron			XP_016869485.1
XM_017013997.1	1936	Intron			XP_016869486.1
XM_017013998.1	1936	Intron			XP_016869487.1
XM_017013999.1	1936	Intron			XP_016869488.1
XM_017014000.1	1936	Intron			XP_016869489.1
XM_017014001.1	1936	Intron			XP_016869490.1

View Full Product Details