Product Details

SNP ID: rs4845557
Assay Type: Validated
NCBI dbSNP Submissions: 48
Location: Chr.1:153636563 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GTGATTTGCTCATTTTACGTATTGT[C/T]CTTTGTAGATTCTCGGGATTCGAAG
Phenotype: MIM: 614206 MIM: 176940 MIM: 601989
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHTOP PubMed Links

Gene Details

Gene: CHTOP
Gene Name: chromatin target of PRMT1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206612.1		Intron			NP_001193541.1
NM_001244664.1		Intron			NP_001231593.1
NM_001317077.1		Intron			NP_001304006.1
NM_015607.3		Intron			NP_056422.2
XM_017000993.1		Intron			XP_016856482.1

Gene: S100A1
Gene Name: S100 calcium binding protein A1

There are no transcripts associated with this gene.

Gene: S100A13
Gene Name: S100 calcium binding protein A13

There are no transcripts associated with this gene.

View Full Product Details