Product Details

SNP ID: rs2042295
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:53795721 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTCACACAGCCAGTAGATGACATAG[C/G]TAATATGTGGCCTCATCTGTATGCC
Phenotype: MIM: 612043 MIM: 612044 MIM: 611954 MIM: 609648
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MIR371A PubMed Links

Gene Details

Gene: MIR371A
Gene Name: microRNA 371a

There are no transcripts associated with this gene.

Gene: MIR371B
Gene Name: microRNA 371b

There are no transcripts associated with this gene.

Gene: MIR372
Gene Name: microRNA 372

There are no transcripts associated with this gene.

Gene: MIR373
Gene Name: microRNA 373

There are no transcripts associated with this gene.

Gene: NLRP12
Gene Name: NLR family pyrin domain containing 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001277126.1		Intron			NP_001264055.1
NM_001277129.1		Intron			NP_001264058.1
NM_144687.3		Intron			NP_653288.1
XM_011527479.1		Intron			XP_011525781.1
XM_011527480.1		Intron			XP_011525782.1
XM_011527482.1		Intron			XP_011525784.1
XM_017027460.1		Intron			XP_016882949.1
XM_017027461.1		Intron			XP_016882950.1
XM_017027462.1		Intron			XP_016882951.1
XM_017027463.1		Intron			XP_016882952.1
XM_017027464.1		Intron			XP_016882953.1
XM_017027465.1		Intron			XP_016882954.1
XM_017027466.1		Intron			XP_016882955.1
XM_017027467.1		Intron			XP_016882956.1

View Full Product Details