Product Details

SNP ID: rs12635
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:13961630 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTACCACACGTGTGGACACTTTCAC[C/T]ACCGGGAGAGGGAGCCCCGTGGGCA
Phenotype: MIM: 600006
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DCAF15 PubMed Links

Gene Details

Gene: DCAF15
Gene Name: DDB1 and CUL4 associated factor 15

There are no transcripts associated with this gene.

Gene: PODNL1
Gene Name: podocan like 1

There are no transcripts associated with this gene.

Gene: RFX1
Gene Name: regulatory factor X1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002918.4	4781	UTR 3			NP_002909.4
XM_011528165.2	4781	UTR 3			XP_011526467.1
XM_011528166.2	4781	UTR 3			XP_011526468.1
XM_011528167.2	4781	UTR 3			XP_011526469.1
XM_011528168.2	4781	UTR 3			XP_011526470.1
XM_011528169.2	4781	UTR 3			XP_011526471.1
XM_011528170.2	4781	UTR 3			XP_011526472.1

View Full Product Details