Product Details

SNP ID: rs2990233
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:155256326 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCCAGCGGCTGCATTGGCAGCTG[C/G]GGTTCGCACCGCAGGGTTGGAGAAG
Phenotype: MIM: 602989 MIM: 606913
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CLK2 PubMed Links

Gene Details

Gene: CLK2
Gene Name: CDC like kinase 2

There are no transcripts associated with this gene.

Gene: FAM189B
Gene Name: family with sequence similarity 189 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267608.1	1147	Intron			NP_001254537.1
NM_006589.2	1147	Intron			NP_006580.2
NM_198264.1	1147	Intron			NP_937995.1
XM_005244845.1	1147	Intron			XP_005244902.1

Gene: SCAMP3
Gene Name: secretory carrier membrane protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005698.3	1147	Missense Mutation	CCA,GCA	P331A	NP_005689.2
NM_052837.2	1147	Missense Mutation	CCA,GCA	P305A	NP_443069.1
XM_006711105.3	1147	Missense Mutation	CCA,GCA	P317A	XP_006711168.1
XM_006711106.3	1147	Missense Mutation	CCA,GCA	P264A	XP_006711169.1
XM_016999991.1	1147	UTR 3			XP_016855480.1

View Full Product Details