Product Details
- SNP ID
-
rs4564250
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.10:133238757 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTCTGCGTTTGTGTTTTAGTCTTTG[T/G]GACATCATCACCACTTTTAGGTTTA
- Phenotype
-
MIM: 604130
MIM: 607158
- Polymorphism
- T/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR202
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs78107994] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR202
- Gene Name
- microRNA 202
There are no transcripts associated with this gene.
- Gene
- MIR202HG
- Gene Name
- MIR202 host gene
There are no transcripts associated with this gene.
- Gene
- UTF1
- Gene Name
- undifferentiated embryonic cell transcription factor 1
There are no transcripts associated with this gene.
- Gene
- VENTX
- Gene Name
- VENT homeobox
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014468.3 |
|
Intron |
|
|
NP_055283.1 |
View Full Product Details