Product Details

SNP ID: rs141052812
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:44258632 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTCACAGGGCAGGCCTGTCTAAAA[A/G]GCCCCAATGCACACAGACATGCATG
Phenotype: MIM: 140572 MIM: 604548 MIM: 610788
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HSP90AB1 PubMed Links

Gene Details

Gene: HSP90AB1
Gene Name: heat shock protein 90 alpha family class B member 1

There are no transcripts associated with this gene.

Gene: MIR4647
Gene Name: microRNA 4647

There are no transcripts associated with this gene.

Gene: NFKBIE
Gene Name: NFKB inhibitor epsilon

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004556.2	2115	UTR 3			NP_004547.2

Gene: SLC35B2
Gene Name: solute carrier family 35 member B2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286509.1	2115	Intron			NP_001273438.1
NM_001286510.1	2115	Intron			NP_001273439.1
NM_001286511.1	2115	Intron			NP_001273440.1
NM_001286512.1	2115	Intron			NP_001273441.1
NM_001286513.1	2115	Intron			NP_001273442.1
NM_001286517.1	2115	Intron			NP_001273446.1
NM_001286519.1	2115	Intron			NP_001273448.1
NM_001286520.1	2115	Intron			NP_001273449.1
NM_178148.3	2115	Intron			NP_835361.1

View Full Product Details