Product Details

SNP ID: rs121909049
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67164867 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGCCAGGCCCCAGCCCCGTGCCTG[A/C]CTTCCTCGGCAAGCTATGGGCGCTG
Phenotype: MIM: 609077 MIM: 602438 MIM: 605235 MIM: 603500
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FBXL8 PubMed Links

Gene Details

Gene: FBXL8
Gene Name: F-box and leucine rich repeat protein 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018378.2	1021	Intron			NP_060848.2

Gene: HSF4
Gene Name: heat shock transcription factor 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040667.2	1021	Missense Mutation	GAC,GCC	D19A	NP_001035757.1
NM_001538.3	1021	Missense Mutation	GAC,GCC	D19A	NP_001529.2

Gene: NOL3
Gene Name: nucleolar protein 3

There are no transcripts associated with this gene.

Gene: TRADD
Gene Name: TNFRSF1A associated via death domain

There are no transcripts associated with this gene.

View Full Product Details