Product Details

SNP ID: rs7774954
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32756412 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTGGGCAGGGGCAGGTGGGCATTA[A/C]AGAAGAGTGATGACCAATCCCAGAC
Phenotype: MIM: 613503 MIM: 615161
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: HLA-DQA2 PubMed Links

Gene Details

Gene: HLA-DQA2
Gene Name: major histocompatibility complex, class II, DQ alpha 2

There are no transcripts associated with this gene.

Gene: HLA-DQB2
Gene Name: major histocompatibility complex, class II, DQ beta 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198858.1	808	UTR 3			NP_001185787.1
NM_001300790.1	808	UTR 3			NP_001287719.1
XM_005249051.4	808	Intron			XP_005249108.1
XM_011514560.2	808	UTR 3			XP_011512862.1
XM_011514561.2	808	UTR 3			XP_011512863.1

Gene: MIR3135B
Gene Name: microRNA 3135b

There are no transcripts associated with this gene.

View Full Product Details