Product Details

SNP ID: rs9933115
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:66557826 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAAGAGAACTGATGTGGGAAGTGAT[A/G]GTGTCAGAAGCACAAGAGGAATAAT
Phenotype: MIM: 616074 MIM: 607884 MIM: 188250
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CKLF PubMed Links

Gene Details

Gene: CKLF
Gene Name: chemokine-like factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040138.2		Intron			NP_001035228.1
NM_016326.3		Intron			NP_057410.1
NM_016951.3		Intron			NP_058647.1
NM_181640.2		Intron			NP_857591.1
NM_181641.2		Intron			NP_857592.1

Gene: CKLF-CMTM1
Gene Name: CKLF-CMTM1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001202509.1		Intron			NP_001189438.1
NM_001204098.1		Intron			NP_001191027.1
NM_001204099.1		Intron			NP_001191028.1

Gene: CMTM1
Gene Name: CKLF like MARVEL transmembrane domain containing 1

There are no transcripts associated with this gene.

Gene: TK2
Gene Name: thymidine kinase 2, mitochondrial

There are no transcripts associated with this gene.

View Full Product Details