Product Details

SNP ID: rs9977039
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:44573789 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGTCTGCTCCAGCGACCTGAGCTAC[A/G]GCAGCCGCGTCTGCCTTCCTGGTTC
Phenotype: MIM: 612920
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KRTAP10-4 PubMed Links

Gene Details

Gene: KRTAP10-4
Gene Name: keratin associated protein 10-4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198687.2	61	Missense Mutation	AGC,GGC	S11G	NP_941960.2

Gene: KRTAP10-5
Gene Name: keratin associated protein 10-5

There are no transcripts associated with this gene.

Gene: TSPEAR
Gene Name: thrombospondin type laminin G domain and EAR repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272037.1	61	Intron			NP_001258966.1
NM_144991.2	61	Intron			NP_659428.2

View Full Product Details