Product Details

SNP ID: rs10850662
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.12:116536323 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGGGCCCTAGTGAATGGATATTTAA[A/C]GGATATCGTACTATTCCTCATCTCC
Phenotype
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: LINC00173 PubMed Links
Additional Information: For this assay, SNP(s) [rs111942413] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.