Product Details

SNP ID

rs7107967

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.11:65376139 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGCTGGGATGTCACCAGCACCACTT[A/G]CCAGCTCACTTGTGCCTCATGCTCC

Phenotype

MIM: 610825

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

SLC25A45 PubMed Links

Additional Information

For this assay, SNP(s) [rs72200075] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SLC25A45

Gene Name

solute carrier family 25 member 45

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077241.2	2144	UTR 3			NP_001070709.2
NM_001278250.2	2144	UTR 3			NP_001265179.2
NM_001278251.2	2144	UTR 3			NP_001265180.2
NM_001300820.1	2144	UTR 3			NP_001287749.1
NM_182556.3	2144	UTR 3			NP_872362.3
XM_006718509.3	2144	UTR 3			XP_006718572.1
XM_006718510.3	2144	UTR 3			XP_006718573.1
XM_011544943.2	2144	UTR 3			XP_011543245.1
XM_011544944.2	2144	UTR 3			XP_011543246.1
XM_011544947.2	2144	Intron			XP_011543249.1
XM_011544949.2	2144	UTR 3			XP_011543251.1
XM_017017562.1	2144	Intron			XP_016873051.1
XM_017017563.1	2144	UTR 3			XP_016873052.1
XM_017017564.1	2144	UTR 3			XP_016873053.1
XM_017017565.1	2144	UTR 3			XP_016873054.1
XM_017017566.1	2144	UTR 3			XP_016873055.1
XM_017017567.1	2144	UTR 3			XP_016873056.1
XM_017017568.1	2144	UTR 3			XP_016873057.1
XM_017017569.1	2144	UTR 3			XP_016873058.1
XM_017017570.1	2144	UTR 3			XP_016873059.1
XM_017017571.1	2144	UTR 3			XP_016873060.1

View Full Product Details