Product Details

SNP ID: rs4803380
Assay Type: DME
NCBI dbSNP Submissions: NA
Location: Chr.19:40845264 on Build GRCh38
Set Membership: DME Validated Inventoried
Context Sequence [VIC/FAM]: GACACAGAGAGGGGCTGGAAGTCCC[C/T]GTAGTCTGGGGGGTGGGGGCGGATA
Phenotype: MIM: 122720
Polymorphism: C/T, Transition substitution
Allele Nomenclature: CYP2A6*12B,g.5163G>A CYP2A6*12C,g.5163G>A CYP2A6*17,g.5163G>A
Literature Links: CYP2A6 PubMed Links
Additional Information: The CYP2A6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2A6. CYP2A6 SNP genotyping assays run on samples lacking CYP2A6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some relatively rare CYP2A6 alleles contain CYP2A7 pseudogene sequences. For accurate CYP2A6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs60286635] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000762.5		Intron			NP_000753.3