Product Details
- SNP ID
-
rs17081799
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:178897430 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- ACGTCACAGGTTCTTATGGTCACAC[A/G]TGAAAACCTTTTCTTCACGTTTGGG
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC107984119
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs77756459] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC107984119
- Gene Name
- zinc finger protein 181-like
- Gene
- ZFP2
- Gene Name
- ZFP2 zinc finger protein
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_030613.3 |
|
Intron |
|
|
NP_085116.2 |
- Gene
- ZNF354B
- Gene Name
- zinc finger protein 354B
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_058230.2 |
|
Intron |
|
|
NP_478137.1 |
View Full Product Details