Product Details

SNP ID: rs17852021
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:58516617 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCCACCCCGATCTCTTCAGCCTC[A/G]GGGTTCGCTCCCTAGAACTCTACCA
Phenotype: MIM: 604917 MIM: 614463 MIM: 616424
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNOT1 PubMed Links

Gene Details

Gene: CNOT1
Gene Name: CCR4-NOT transcription complex subunit 1

There are no transcripts associated with this gene.

Gene: NDRG4
Gene Name: NDRG family member 4

There are no transcripts associated with this gene.

Gene: SETD6
Gene Name: SET domain containing 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160305.2	603	Missense Mutation	AGG,GGG	R206G	NP_001153777.1
NM_024860.3	603	Missense Mutation	AGG,GGG	R182G	NP_079136.2
XM_011523336.1	603	Missense Mutation	AGG,GGG	R206G	XP_011521638.1

View Full Product Details