Product Details

SNP ID: hCV86550513
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:673966 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGAACAGGGCGGAGTAGCGGCCGA[G/T]CTGCGAAAGAGGTTGGTCAGAGGCG
Phenotype: MIM: 601519 MIM: 160782 MIM: 180072
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ATP5I PubMed Links

Gene Details

Gene: ATP5I
Gene Name: ATP synthase, H+ transporting, mitochondrial Fo complex subunit E

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007100.3	128	Missense Mutation	ATC,CTC	I13L	NP_009031.1

Gene: MFSD7
Gene Name: major facilitator superfamily domain containing 7

There are no transcripts associated with this gene.

Gene: MYL5
Gene Name: myosin light chain 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002477.1	128	Intron			NP_002468.1

Gene: PDE6B
Gene Name: phosphodiesterase 6B

There are no transcripts associated with this gene.

View Full Product Details