Product Details

SNP ID: rs73887420
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:184243094 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCATGCCTTTGGGCAAGTTTATTAA[C/T]CTCTCTGGACCTGCTCCTCAACCAA
Phenotype: MIM: 608750 MIM: 610145 MIM: 611620
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ALG3 PubMed Links

Gene Details

Gene: ALG3
Gene Name: ALG3, alpha-1,3- mannosyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006941.2		Intron			NP_001006942.1
NM_005787.5		Intron			NP_005778.1
XM_011512322.1		Intron			XP_011510624.1
XM_011512323.2		Intron			XP_011510625.1

Gene: ECE2
Gene Name: endothelin converting enzyme 2

There are no transcripts associated with this gene.

Gene: MIR1224
Gene Name: microRNA 1224

There are no transcripts associated with this gene.

Gene: VWA5B2
Gene Name: von Willebrand factor A domain containing 5B2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320373.1		Intron			NP_001307302.1
NM_138345.2		Intron			NP_612354.1
XM_011513288.2		Intron			XP_011511590.1
XM_011513289.2		Intron			XP_011511591.1
XM_011513290.2		Intron			XP_011511592.1
XM_011513291.2		Intron			XP_011511593.1
XM_011513292.2		Intron			XP_011511594.1

View Full Product Details