Product Details

SNP ID: rs4755217
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:43924069 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TTTAGCTCTGGATGCAAATTCTGGT[A/G]TCTGAAAGGGAAGGAAAGGGGAAAG
Phenotype: MIM: 610603
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACCSL PubMed Links

Gene Details

Gene: ACCSL
Gene Name: 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001031854.2		Intron			NP_001027025.2
XM_017017714.1		Intron			XP_016873203.1
XM_017017715.1		Intron			XP_016873204.1

Gene: ALKBH3
Gene Name: alkB homolog 3, alpha-ketoglutaratedependent dioxygenase

There are no transcripts associated with this gene.

Gene: ALKBH3-AS1
Gene Name: ALKBH3 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details