Product Details

SNP ID: rs15922
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:34883049 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAATGATGAGTCTTCCCTTTCAACT[C/G]TTGTTAAATCTGAGACATCCTGACT
Phenotype: MIM: 608994 MIM: 600772
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ANKS1A PubMed Links

Gene Details

Gene: ANKS1A
Gene Name: ankyrin repeat and sterile alpha motif domain containing 1A

There are no transcripts associated with this gene.

Gene: LOC105375030
Gene Name: uncharacterized LOC105375030

There are no transcripts associated with this gene.

Gene: TAF11
Gene Name: TATA-box binding protein associated factor 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270488.1	707	Missense Mutation	ACA,AGA	T68R	NP_001257417.1
NM_005643.3	707	Missense Mutation	ACA,AGA	T68R	NP_005634.1
XM_011514827.2	707	Missense Mutation	ACA,AGA	T24R	XP_011513129.1

Gene: UHRF1BP1
Gene Name: UHRF1 binding protein 1

There are no transcripts associated with this gene.

View Full Product Details