Product Details

SNP ID: rs12811109
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:122986547 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: CGTCCTTGGTGGAGCCATAGGCCGC[A/G]TGCACGCGCAGGTGCAGCTGTGGGG
Phenotype: MIM: 607668 MIM: 608920
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARL6IP4 PubMed Links

Gene Details

Gene: ARL6IP4
Gene Name: ADP ribosylation factor like GTPase 6 interacting protein 4

There are no transcripts associated with this gene.

Gene: OGFOD2
Gene Name: 2-oxoglutarate and iron dependent oxygenase domain containing 2

There are no transcripts associated with this gene.

Gene: PITPNM2
Gene Name: phosphatidylinositol transfer protein membrane associated 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300801.1	4076	Silent Mutation	CAC,CAT	H1199H	NP_001287730.1
NM_020845.2	4076	Silent Mutation	CAC,CAT	H1205H	NP_065896.1
XM_011538590.2	4076	Silent Mutation	CAC,CAT	H1238H	XP_011536892.1

View Full Product Details