Product Details

SNP ID

rs35475086

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.11:123368814 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATTTGGGGTTTCATTCATTATCTTG[A/G]CAAAAATAGTGTCAATGAAGTCCCA

Phenotype

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

GRAMD1B PubMed Links

Additional Information

For this assay, SNP(s) [rs112379089] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

GRAMD1B

Gene Name

GRAM domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286563.1		Intron			NP_001273492.1
NM_001286564.1		Intron			NP_001273493.1
NM_020716.2		Intron			NP_065767.1
XM_005271619.4		Intron			XP_005271676.1
XM_005271621.4		Intron			XP_005271678.1
XM_005271623.4		Intron			XP_005271680.1
XM_005271624.4		Intron			XP_005271681.2
XM_006718892.3		Intron			XP_006718955.1
XM_011542926.2		Intron			XP_011541228.1
XM_011542929.2		Intron			XP_011541231.1
XM_011542930.2		Intron			XP_011541232.1
XM_011542931.2		Intron			XP_011541233.1
XM_011542933.1		Intron			XP_011541235.1
XM_017018034.1		Intron			XP_016873523.1
XM_017018035.1		Intron			XP_016873524.1
XM_017018036.1		Intron			XP_016873525.1
XM_017018037.1		Intron			XP_016873526.1
XM_017018038.1		Intron			XP_016873527.1
XM_017018039.1		Intron			XP_016873528.1
XM_017018040.1		Intron			XP_016873529.1
XM_017018041.1		Intron			XP_016873530.1
XM_017018042.1		Intron			XP_016873531.1
XM_017018043.1		Intron			XP_016873532.1
XM_017018044.1		Intron			XP_016873533.1
XM_017018045.1		Intron			XP_016873534.1
XM_017018046.1		Intron			XP_016873535.1
XM_017018047.1		Intron			XP_016873536.1
XM_017018048.1		Intron			XP_016873537.1
XM_017018049.1		Intron			XP_016873538.1
XM_017018050.1		Intron			XP_016873539.1
XM_017018051.1		Intron			XP_016873540.1

View Full Product Details