Product Details

SNP ID
rs12622131
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.2:213006151 on Build GRCh38
Set Membership
HapMap Validated
Context Sequence [VIC/FAM]
CCCTAGTTCTGTAACCTTACAGGGT[C/T]CAAGTTACCAGATTCAGGCCAAATT
Phenotype
MIM: 606234
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
IKZF2 PubMed Links
Additional Information
For this assay, SNP(s) [rs6744541] are located under a probe and SNP(s) [rs7593386] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
IKZF2
Gene Name
IKAROS family zinc finger 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001079526.1 3002 UTR 3 NP_001072994.1
NM_016260.2 3002 UTR 3 NP_057344.2
XM_005246384.4 3002 UTR 3 XP_005246441.1
XM_005246385.3 3002 UTR 3 XP_005246442.1
XM_005246386.4 3002 UTR 3 XP_005246443.1
XM_011510802.2 3002 UTR 3 XP_011509104.1
XM_011510803.2 3002 UTR 3 XP_011509105.1
XM_011510804.2 3002 UTR 3 XP_011509106.1
XM_011510805.2 3002 UTR 3 XP_011509107.1
XM_011510807.2 3002 UTR 3 XP_011509109.1
XM_011510808.2 3002 UTR 3 XP_011509110.1
XM_011510809.2 3002 UTR 3 XP_011509111.1
XM_011510810.2 3002 UTR 3 XP_011509112.1
XM_011510811.2 3002 UTR 3 XP_011509113.1
XM_011510812.2 3002 UTR 3 XP_011509114.1
XM_011510814.2 3002 UTR 3 XP_011509116.1
XM_011510815.2 3002 UTR 3 XP_011509117.1
XM_011510816.2 3002 UTR 3 XP_011509118.1
XM_011510817.2 3002 UTR 3 XP_011509119.1
XM_011510818.2 3002 UTR 3 XP_011509120.1
XM_011510819.2 3002 UTR 3 XP_011509121.1
XM_017003589.1 3002 UTR 3 XP_016859078.1
XM_017003590.1 3002 UTR 3 XP_016859079.1
XM_017003591.1 3002 UTR 3 XP_016859080.1
XM_017003592.1 3002 UTR 3 XP_016859081.1

View Full Product Details